Journal of Rheumatic Diseases

Table. 1.

Primer sequences for qPCR

Gene 5’------Forward------3’ 5’------Reverse------3’
GAPDH GTAACCCGTTGAACCCCATTC CCATCCAATCGGTAGTAGCG
OSTEOCALCIN (OCN) ATGAGAGCCCTCACACTCCT CTTGGACACAAAGGCTGCAC
DKK1 GTGGCCTTCAAGGTGGTAG ACTCTTGCCTCGTCCACTC
GAPDH for ChIP TGCAACACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG
DKK1 for ChIP GAGCGACTAAGCAAGGGAGG ACCGCGGCTGCCTTTATAC
J Rheum Dis 2021;28:216~224 https://doi.org/10.4078/jrd.2021.28.4.216
© J Rheum Dis